# scPipe
[](https://travis-ci.org/LuyiTian/scPipe)
[](https://codecov.io/gh/LuyiTian/scPipe)
<img src=inst/scPipe.png height="200">
scPipe is an R package that allows barcode demultiplexing, transcript mapping and quality control of raw sequencing data generated by multiple 3 prime end sequencing protocols including CEL-seq, MARS-seq, Chromium 10x and Drop-seq. scPipe produces a count matrix that is essential for downstream analysis along with a user-friendly HTML report that summarises data quality. These results can be used as input for downstream analyses including normalization, visualization and statistical testing.
The package is under active development. Feel free to ask any questions or submit a pull request.
* [21/09/2017] scPipe now uses the *SingleCellExperiment* class.
## Installation
### From Bioconductor
```
if (!requireNamespace("BiocManager", quietly=TRUE))
install.packages("BiocManager")
BiocManager::install("scPipe")
```
### From GitHub (Developmental version)
```{r}
install.packages("devtools")
devtools::install_github("LuyiTian/scPipe")
```
## Getting started
The general workflow of scPipe is illustrated in the following figure:
<img src=inst/workflow.png height="800">
### Data Preprocessing
* The `sc_trim_barcode` function will reformat each read and put the cell barcode and UMI sequence into the fastq read names: `@ACGATCGA_TAGAGC#SIMULATE_SEQ::002::000::0000::0
AAGACGTCTAAGGGCGGTGTACACCCTTTTGAGCAATGATTGCACAACCTGCGATCACCTTATACAGAATTAT+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA`
* After alignment, the `sc_exon_mapping` function will put the cell barcode and UMI into the bam file with different tags, together with gene information: `AAAGTCAA_AACTCA#SIMULATE_SEQ::007::000::0013::10 0 ERCC-00171 142 40 73M * 0 0 GCCTCGGGAATAAGCTGACGGTGACAAGGTTTCCCCCTAATCGAGACGCTGCAATAACACAGGGGCATACAGT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA HI:i:1 NH:i:1 NM:i:0 GE:Z:ERCC-00171 YC:Z:AAAGTCAA YM:Z:AACTCA YE:i:-364`. In this example the cell barcode is AAAGTCAA with tag `YC`, the UMI is AACTCA with tag `YM` and the gene that this read maps to is `ERCC-00171` with tag `GE`. This read is located 364 bp upstream of the transcription end site (TES), which is stored in the `YE` tag.
* The `sc_demultiplex` function will look for the cell barcode in BAM file (by default in the `YC` tag) and compare it against the known cell barcode annotation file, which is a csv file consisting of two columns. The first column is the cell name and second column is the cell barcode. For Chromium 10x and Drop-seq data we can run `sc_detect_bc` to find the barcodes and generate the cell barcode annotation file before running `sc_demultiplex`. An example barcode annotation file is availab in the package from `system.file("extdata", "barcode_anno.csv", package = "scPipe")`. The output of `sc_demultiplex` will be multiple csv files corresponding to each cell. Each file has three columns, the first of which contains the gene id, the second column contains the UMI sequence and third column gives the relative location of the read to the TES. These files are used for `sc_gene_counting`.
For further examples see the vignette.
## Acknowledgements
This package is inspired by the `scater` and `scran` packages. The idea to put cell barcode and UMI sequences into the BAM file is from [Drop-seq tools](http://mccarrolllab.com/dropseq/). We thank Dr Aaron Lun for suggestions on package development.
