git-svn-id: file:///home/git/hedgehog.fhcrc.org/bioconductor/trunk/madman/Rpacks/CNEr@105636 bc3139a8-67e5-0310-9ffc-ced21a209358
Ge Tan authored on 29/06/2015 20:44:23
| ... | ... |
@@ -1,6 +1,6 @@ |
| 1 | 1 |
Package: CNEr |
| 2 |
-Version: 1.5.3 |
|
| 3 |
-Date: 2015-05-11 |
|
| 2 |
+Version: 1.5.4 |
|
| 3 |
+Date: 2015-06-29 |
|
| 4 | 4 |
Title: CNE Detection and Visualization |
| 5 | 5 |
Description: Large-scale identification and advanced visualization of sets of conserved noncoding elements. |
| 6 | 6 |
Author: Ge Tan <ge.tan09@imperial.ac.uk> |
| ... | ... |
@@ -11,7 +11,7 @@ |
| 11 | 11 |
NXX <- function(filepath, XX=50){
|
| 12 | 12 |
if(grepl("\\.2bit$", filepath, ignore.case=TRUE)){
|
| 13 | 13 |
lengths <- seqlengths(TwoBitFile(filepath)) |
| 14 |
- }else if(grepl("(\\.fa$ | \\.fasta$)", filepath, ignore.case=TRUE)){
|
|
| 14 |
+ }else if(grepl("(\\.fa$|\\.fasta$)", filepath, ignore.case=TRUE)){
|
|
| 15 | 15 |
lengths <- fasta.info(filepath) |
| 16 | 16 |
}else{
|
| 17 | 17 |
stop("The suffix can only be .2bit, .fa, .fasta!")
|
| 18 | 18 |
new file mode 100644 |
| ... | ... |
@@ -0,0 +1,184 @@ |
| 1 |
+############################ build package ###################################### |
|
| 2 |
+ |
|
| 3 |
+R_dev CMD build CNEr |
|
| 4 |
+R_dev CMD build --no-build-vignettes --no-manual CNEr |
|
| 5 |
+R_dev CMD INSTALL CNEr_1.5.4.tar.gz |
|
| 6 |
+R_dev CMD check CNEr_1.5.4.tar.gz |
|
| 7 |
+ |
|
| 8 |
+library(devtools) |
|
| 9 |
+reload(inst("CNEr"))
|
|
| 10 |
+ |
|
| 11 |
+### readAxt |
|
| 12 |
+library(CNEr) |
|
| 13 |
+axtFileshg19danRer7 = list.files(path="/Users/gtan/CSC/CNEr/axtNet", pattern=".*hg19\\.danRer7\\.*", full.names=TRUE) |
|
| 14 |
+axtshg19danRer7 = readAxt(axtFileshg19danRer7) |
|
| 15 |
+axtFilesdanRer7hg19 = list.files(path="/Users/gtan/CSC/CNEr/axtNet", pattern=".*danRer7\\.hg19\\.*", full.names=TRUE) |
|
| 16 |
+axtsdanRer7hg19 = readAxt(axtFilesdanRer7hg19) |
|
| 17 |
+ |
|
| 18 |
+## subAxt |
|
| 19 |
+ dyn.load("/Users/gtan/Repositories/Bitbucket/CNEr/src/alignment.so")
|
|
| 20 |
+ .Call("subAlignment", c(92822L, 95115L), c(92873L, 95180L),
|
|
| 21 |
+ c("CAAAACCAGATGCTGTGAGAATACTTTATTAGT----CAAAACCGCATA---CTATAAA", "TGCCAACCTTGGCGCCGATCTGATTCCCGCACTGCCCGATCTGCGTGAGCACGATCTCCCTCATGG"),
|
|
| 22 |
+ c(1812440L, 47866092L), c(1812495L, 47866157L), |
|
| 23 |
+ c("CAAAAC---ATATCATAACTGTACCTTGTTTGTTCCACAAGATTGCATCTTTCCTTAAA",
|
|
| 24 |
+ "TTCCTACCTTGGCACCAATCTGGTTGCCGCACTGTCCAGCCTGTAAATGCACGATCTCCCTCATTG"), |
|
| 25 |
+ c(92863L, 95115L), c(92873L, 95120L), |
|
| 26 |
+ c(59L, 66L)) |
|
| 27 |
+ |
|
| 28 |
+ |
|
| 29 |
+subAxt(x, "chr10", 92866L, 92873L, select="target") |
|
| 30 |
+mm10ChromSizes <- fetchChromSizes("mm10")
|
|
| 31 |
+subAxt(x, chr="chr2", start=1812441, end=1812494, select="query", qSize=seqlengths(mm10ChromSizes["chr2"])) |
|
| 32 |
+subAxt(x, chr="chr14", start=77037081, end=77039623, select="query", qSize=seqlengths(mm10ChromSizes["chr14"])) |
|
| 33 |
+ |
|
| 34 |
+subAxt(axtHg19DanRer7, chr="chr11", start=31500113, end=31500120, select="target") |
|
| 35 |
+ |
|
| 36 |
+foo2 = .subAxtMultiple(axtHg19DanRer7, chr="chr11", start=31500113, end=31500120, select="target") |
|
| 37 |
+ |
|
| 38 |
+foo3 = .subAxtMultiple(axtHg19DanRer7, chr="chr11", start=c(31082021, 32461267), end=c(31082862,32461581), select="target") |
|
| 39 |
+ |
|
| 40 |
+ |
|
| 41 |
+## readBedToGRanges |
|
| 42 |
+bedhg19 = readBed("/Users/gtan/CSC/CNEr/filters/filter_regions.hg19.bed")
|
|
| 43 |
+beddanRer7 = readBed("/Users/gtan/CSC/CNEr/filters/filter_regions.danRer7.bed")
|
|
| 44 |
+library(rtracklayer) |
|
| 45 |
+qSizesdanRer7 = seqinfo(TwoBitFile("/Users/gtan/CSC/CNEr/2bit/danRer7.2bit"))
|
|
| 46 |
+qSizeshg19 = seqinfo(TwoBitFile("/Users/gtan/CSC/CNEr/2bit/hg19.2bit"))
|
|
| 47 |
+ |
|
| 48 |
+## ceScan |
|
| 49 |
+# debug |
|
| 50 |
+axts = axtshg19danRer7 |
|
| 51 |
+tFilter= bedhg19 |
|
| 52 |
+qFilter= beddanRer7 |
|
| 53 |
+qSizes= qSizesdanRer7 |
|
| 54 |
+winSize=50 |
|
| 55 |
+minScore=45 |
|
| 56 |
+resFiles = tempfile(pattern = paste(minScore, winSize, "ceScan", sep="-"), tmpdir = tempdir(), fileext = "") |
|
| 57 |
+foo = .Call("myCeScan", as.character(seqnames(tFilter)),
|
|
| 58 |
+ start(tFilter), end(tFilter), |
|
| 59 |
+ as.character(seqnames(qFilter)), start(qFilter), end(qFilter), |
|
| 60 |
+ as.character(seqnames(qSizes)), as.integer(seqlengths(qSizes)), |
|
| 61 |
+ as.character(seqnames(targetRanges(axts))), |
|
| 62 |
+ start(targetRanges(axts)), end(targetRanges(axts)), |
|
| 63 |
+ as.character(strand(targetRanges(axts))), |
|
| 64 |
+ as.character(targetSeqs(axts)), |
|
| 65 |
+ as.character(seqnames(queryRanges(axts))), |
|
| 66 |
+ start(queryRanges(axts)), end(queryRanges(axts)), |
|
| 67 |
+ as.character(strand(queryRanges(axts))), |
|
| 68 |
+ as.character(querySeqs(axts)), |
|
| 69 |
+ score(axts), symCount(axts), winSize, minScore, |
|
| 70 |
+ as.character(resFiles)) |
|
| 71 |
+foo = .Call("myCeScan", NULL,
|
|
| 72 |
+ NULL, NULL, |
|
| 73 |
+ as.character(seqnames(qFilter)), start(qFilter), end(qFilter), |
|
| 74 |
+ as.character(seqnames(qSizes)), as.integer(seqlengths(qSizes)), |
|
| 75 |
+ as.character(seqnames(targetRanges(axts))), |
|
| 76 |
+ start(targetRanges(axts)), end(targetRanges(axts)), |
|
| 77 |
+ as.character(strand(targetRanges(axts))), |
|
| 78 |
+ as.character(targetSeqs(axts)), |
|
| 79 |
+ as.character(seqnames(queryRanges(axts))), |
|
| 80 |
+ start(queryRanges(axts)), end(queryRanges(axts)), |
|
| 81 |
+ as.character(strand(queryRanges(axts))), |
|
| 82 |
+ as.character(querySeqs(axts)), |
|
| 83 |
+ score(axts), symCount(axts), winSize, minScore, |
|
| 84 |
+ as.character(resFiles)) |
|
| 85 |
+ |
|
| 86 |
+# end of debug |
|
| 87 |
+CNEhg19_danRer7 = ceScan(axtshg19danRer7, qFilter=beddanRer7, qSizes=qSizesdanRer7, thresholds=c("45,50", "48,50", "49,50"))
|
|
| 88 |
+CNEhg19_danRer7_2 = ceScan(axtshg19danRer7, bedhg19, beddanRer7, qSizesdanRer7, thresholds=c("45,50", "48,50", "49,50"))
|
|
| 89 |
+ |
|
| 90 |
+CNEdanRer7_hg19 = ceScan(axtsdanRer7hg19, beddanRer7, bedhg19, qSizeshg19, thresholds=c("45,50", "48,50", "49,50"))
|
|
| 91 |
+ |
|
| 92 |
+## ceScan File |
|
| 93 |
+bedhg19File = "/export/data/CNEs/hg19/filters/filter_regions.hg19.bed" |
|
| 94 |
+beddanRer7File = "/export/data/CNEs/danRer7/filters/filter_regions.danRer7.bed" |
|
| 95 |
+CNEhg19_danRer7 = ceScanFile(axtFileshg19danRer7, bedhg19File, beddanRer7File , qSizesdanRer7, thresholds=c("45,50", "48,50", "49,50"))
|
|
| 96 |
+CNEdanRer7_hg19 = ceScanFile(axtFilesdanRer7hg19, beddanRer7File, bedhg19File, qSizeshg19, thresholds=c("45,50", "48,50", "49,50"))
|
|
| 97 |
+ |
|
| 98 |
+ |
|
| 99 |
+## ceMerge |
|
| 100 |
+data(CNEDanRer7Hg19) |
|
| 101 |
+data(CNEHg19DanRer7) |
|
| 102 |
+cneMerge(CNEDanRer7Hg19[[1]], CNEHg19DanRer7[[1]]) |
|
| 103 |
+ |
|
| 104 |
+## blatCNE |
|
| 105 |
+assemblyhg19Twobit = "/export/data/goldenpath/hg19/assembly.2bit" |
|
| 106 |
+assemblydanRer7Twobit = "/export/data/goldenpath/danRer7/assembly.2bit" |
|
| 107 |
+cneBlateddanRer7_hg19 = list() |
|
| 108 |
+for(i in 1:length(cneMergeddanRer7hg19)){
|
|
| 109 |
+ cneBlateddanRer7_hg19[[names(cneMergeddanRer7_hg19)[i]]] = blatCNE(cneMergeddanRer7_hg19[[i]], sub("\\d+_", "", names(cneMergeddanRer7_hg19)[i]), 8, 4, assemblydanRer7Twobit, assemblyhg19Twobit)
|
|
| 110 |
+} |
|
| 111 |
+ |
|
| 112 |
+## saveCNE |
|
| 113 |
+tableName = "cne_twoWay_danRer7_hg19_len50_id900_v1" |
|
| 114 |
+dbName = "/mnt/biggley/home/gtan/work/debug/CNEr-29-07-2013/cne.sqlite" |
|
| 115 |
+for(i in 1:length(cneBlateddanRer7_hg19)){
|
|
| 116 |
+ tableName = paste0("cne_twoWay_danRer7_hg19_len50_id", as.integer(sub("_\\d+$", "", names(cneBlateddanRer7_hg19)[i]))*20, "_v1")
|
|
| 117 |
+ saveCNEToSQLite(cneBlateddanRer7_hg19[[i]], dbName, tableName, overwrite=TRUE) |
|
| 118 |
+} |
|
| 119 |
+ |
|
| 120 |
+# readCNERangesFromSQLite |
|
| 121 |
+chr = "chr6" |
|
| 122 |
+CNEstart = 19900000 |
|
| 123 |
+CNEend = 28000000 |
|
| 124 |
+minLength = 50 |
|
| 125 |
+dbName = "/Users/gtan/CSC/CNEr/CNESQL/cne.sqlite" |
|
| 126 |
+tableName = "cne2wBf_danRer7_hg19_27_30" |
|
| 127 |
+fetchedCNERanges = readCNERangesFromSQLite(dbName, tableName, chr, CNEstart, CNEend, whichAssembly="1", minLength) |
|
| 128 |
+ |
|
| 129 |
+##CNEAnnotate |
|
| 130 |
+windowSize= 300 |
|
| 131 |
+cne2wBf_danRer7_hg19_21_30 = CNEAnnotate(dbName, "cne2wBf_danRer7_hg19_21_30", whichAssembly="1", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 132 |
+cne2wBf_danRer7_hg19_40_50 = CNEAnnotate(dbName, "cne2wBf_danRer7_hg19_40_50", whichAssembly="1", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 133 |
+cne2wBf_danRer7_hg19_49_50 = CNEAnnotate(dbName, "cne2wBf_danRer7_hg19_49_50", whichAssembly="1", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 134 |
+ |
|
| 135 |
+cne2wBf_danRer7_tetNig2_21_30 = CNEAnnotate(dbName, "cne2wBf_danRer7_tetNig2_21_30", whichAssembly="1", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 136 |
+cne2wBf_danRer7_tetNig2_40_50 = CNEAnnotate(dbName, "cne2wBf_danRer7_tetNig2_40_50", whichAssembly="1", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 137 |
+cne2wBf_danRer7_tetNig2_49_50 = CNEAnnotate(dbName, "cne2wBf_danRer7_tetNig2_49_50", whichAssembly="1", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 138 |
+### new Gviz way |
|
| 139 |
+genome = "danRer7" |
|
| 140 |
+strand = "+" |
|
| 141 |
+dataMatrix= cne2wBf_danRer7_hg19_21_30 |
|
| 142 |
+dTrack1 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horiz", horizon.scale=1, fill.horizon=c("#B41414", "#E03231", "#F7A99C", "yellow", "orange", "red"), name="hg19 21/30")
|
|
| 143 |
+dataMatrix = cne2wBf_danRer7_hg19_40_50 |
|
| 144 |
+dTrack2 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horiz", horizon.scale=1, fill.horizon=c("#B41414", "#E03231", "#F7A99C", "yellow", "orange", "red"), name="hg19 45/50")
|
|
| 145 |
+dataMatrix = cne2wBf_danRer7_hg19_49_50 |
|
| 146 |
+dTrack3 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horiz", horizon.scale=1, fill.horizon=c("#B41414", "#E03231", "#F7A99C", "yellow", "orange", "red"), name="hg19 49/50")
|
|
| 147 |
+ |
|
| 148 |
+dataMatrix= cne2wBf_danRer7_tetNig2_21_30 |
|
| 149 |
+dTrack4 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horiz", horizon.scale=2, fill.horizon=c("#B41414", "#E03231", "#F7A99C", "yellow", "orange", "red"), name="tetNig2 21/30")
|
|
| 150 |
+dataMatrix = cne2wBf_danRer7_tetNig2_40_50 |
|
| 151 |
+dTrack5 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horiz", horizon.scale=2, fill.horizon=c("#B41414", "#E03231", "#F7A99C", "yellow", "orange", "red"), name="tetNig2 45/50")
|
|
| 152 |
+dataMatrix = cne2wBf_danRer7_tetNig2_49_50 |
|
| 153 |
+dTrack6 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horiz", horizon.scale=2, fill.horizon=c("#B41414", "#E03231", "#F7A99C", "yellow", "orange", "red"), name="tetNig2 49/50")
|
|
| 154 |
+ |
|
| 155 |
+axisTrack <- GenomeAxisTrack() |
|
| 156 |
+ideoTrack <- IdeogramTrack(genome = "danRer7", chromosome = chr) |
|
| 157 |
+refGeneAnnotation = queryAnnotationSQLite(dbname="/Users/gtan/CSC/CNEr/annotationSQL/geneAnnotation.sqlite", tablename="danRer7_refGene", chr=chr, start= CNEstart, end= CNEend) |
|
| 158 |
+refgrtrack <- GeneRegionTrack(refGeneAnnotation, genome = "danRer7", chromosome = chr, name = "refGene") |
|
| 159 |
+ensGeneAnnotation = queryAnnotationSQLite(dbname="/Users/gtan/CSC/CNEr/annotationSQL/geneAnnotation.sqlite", tablename="danRer7_ensGene", chr=chr, start= CNEstart, end= CNEend) |
|
| 160 |
+ensgrtrack = GeneRegionTrack(ensGeneAnnotation, genome = "danRer7", chromosome = chr, name = "ensGene") |
|
| 161 |
+ |
|
| 162 |
+cpgIslands = UcscTrack(genome = "danRer7", chromosome = chr, track = "cpgIslandExt", from=CNEstart, to=CNEend, trackType = "AnnotationTrack", start = "chromStart",end = "chromEnd", id = "name", shape = "box", fill = "#006400", name = "CpG Islands") |
|
| 163 |
+plotTracks(list(axisTrack,ideoTrack, refgrtrack, cpgIslands, dTrack1, dTrack2, dTrack3, dTrack4, dTrack5, dTrack6), collapseTranscripts = TRUE, shape = "arrow", from= CNEstart, to= CNEend, showId = TRUE, extend.left = 20000) |
|
| 164 |
+ |
|
| 165 |
+### old Gviz way |
|
| 166 |
+ |
|
| 167 |
+ |
|
| 168 |
+### prepare gene annotation sqlite3 |
|
| 169 |
+makeGeneDbFromUCSC(genome="danRer7", tablename="refGene", dbnameSQLite="/Users/gtan/CSC/CNEr/annotationSQL/geneAnnotation.sqlite") |
|
| 170 |
+makeGeneDbFromUCSC(genome="danRer7", tablename="ensGene", dbnameSQLite="/Users/gtan/CSC/CNEr/annotationSQL/geneAnnotation.sqlite") |
|
| 171 |
+ |
|
| 172 |
+ |
|
| 173 |
+############################################# readBinary############## |
|
| 174 |
+axtFiles ="/mnt/biggley/data/pairwiseAlignments/ucsc/axtNet/hg19.danRer7.net.axt" |
|
| 175 |
+fn = file(axtFiles, "rb") |
|
| 176 |
+foo = readBin(fn, raw(), file.info(axtFiles)$size) |
|
| 177 |
+rawToChar(foo[1:16]) |
|
| 178 |
+index = grepRaw("\n", foo, fixed=TRUE)
|
|
| 179 |
+ |
|
| 180 |
+targetRanges="GRanges", targetSeqs="DNAStringSet",queryRanges="GRanges", querySeqs="DNAStringSet", score="integer", symCount="integer" |
|
| 181 |
+ ) |
|
| 182 |
+ |
|
| 183 |
+ |
|
| 184 |
+ |
| 0 | 185 |
new file mode 100644 |
| ... | ... |
@@ -0,0 +1,75 @@ |
| 1 |
+### Human VS Dog |
|
| 2 |
+selfDir = "~/Repos/CSC/CNEr/R" |
|
| 3 |
+selfScripts = list.files(path=selfDir, pattern='.*\\.r$', full.names=TRUE, recursive=TRUE) |
|
| 4 |
+for(rs in selfScripts){message(rs);source(rs)}
|
|
| 5 |
+ |
|
| 6 |
+axtFiles = list.files(path="/export/downloads/ucsc/axtNet/hg19", pattern=".*hg19\\.canFam3\\.*", full.names=TRUE) |
|
| 7 |
+axtFiles = axtFiles[1:5] |
|
| 8 |
+axts_hg19_canFam3 = readAxt(axtFiles) |
|
| 9 |
+axtFiles = list.files(path="/export/downloads/ucsc/axtNet/canFam3", pattern=".*canFam3\\.hg19\\.*", full.names=TRUE) |
|
| 10 |
+axts_canFam3_hg19 = readAxt(axtFiles) |
|
| 11 |
+ |
|
| 12 |
+bed_hg19 = readBedToGRanges("/export/data/CNEs/hg19/filters/filter_regions.hg19.bed")
|
|
| 13 |
+bed_canFam3 = readBedToGRanges("/export/data/CNEs/canFam3/filters/filter_regions.canFam3.bed")
|
|
| 14 |
+qSizes_canFam3 = seqinfo(TwoBitFile("/export/data/goldenpath/canFam3/assembly.2bit"))
|
|
| 15 |
+qSizes_hg19 = seqinfo(TwoBitFile("/export/data/goldenpath/hg19/assembly.2bit"))
|
|
| 16 |
+ |
|
| 17 |
+CNE_hg19_canFam3 = ceScan(axts_hg19_canFam3, bed_hg19, bed_canFam3, qSizes_canFam3, thresholds=c("29,30", "30,30", "35,50", "40,50", "45,50", "48,50", "49,50"))
|
|
| 18 |
+CNE_canFam3_hg19 = ceScan(axts_canFam3_hg19, bed_canFam3, bed_hg19, qSizes_hg19, thresholds=c("29,30", "30,30", "35,50", "40,50", "45,50", "48,50", "49,50"))
|
|
| 19 |
+ |
|
| 20 |
+cneMerged_canFam3_hg19 = mapply(ceMerge, CNE_canFam3_hg19, CNE_hg19_canFam3, SIMPLIFY=FALSE) |
|
| 21 |
+ |
|
| 22 |
+assembly_hg19_Twobit = "/export/data/goldenpath/hg19/assembly.2bit" |
|
| 23 |
+assembly_canFam3_Twobit = "/export/data/goldenpath/canFam3/assembly.2bit" |
|
| 24 |
+ |
|
| 25 |
+cneBlated_canFam3_hg19 = list() |
|
| 26 |
+for(i in 1:length(cneMerged_canFam3_hg19)){
|
|
| 27 |
+ cneBlated_canFam3_hg19[[names(cneMerged_canFam3_hg19)[i]]] = blatCNE(cneMerged_canFam3_hg19[[i]], sub("\\d+_", "", names(cneMerged_canFam3_hg19)[i]), 4, 4, assembly_canFam3_Twobit, assembly_hg19_Twobit)
|
|
| 28 |
+} |
|
| 29 |
+ |
|
| 30 |
+ |
|
| 31 |
+# readCNERangesFromSQLite |
|
| 32 |
+chr = "chr16" |
|
| 33 |
+CNEstart = 45000000 |
|
| 34 |
+CNEend = 60000000 |
|
| 35 |
+minLength = 50 |
|
| 36 |
+fetchedCNERanges = readCNERangesFromSQLite(dbName, tableName, chr, CNEstart, CNEend, whichAssembly="2", minLength) |
|
| 37 |
+ |
|
| 38 |
+##CNEAnnotate |
|
| 39 |
+windowSize= 300 |
|
| 40 |
+dbName = "/Users/gtan/Dropbox/Project/CSC/CNEr/cne.sqlite" |
|
| 41 |
+hg19_canFam3_len50_id900_300 = CNEAnnotate(dbName, "cne_twoWay_canFam3_hg19_len50_id900_v1", whichAssembly="2", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 42 |
+hg19_canFam3_len50_id960_300 = CNEAnnotate(dbName, "cne_twoWay_canFam3_hg19_len50_id960_v1", whichAssembly="2", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 43 |
+hg19_canFam3_len50_id980_300 = CNEAnnotate(dbName, "cne_twoWay_canFam3_hg19_len50_id980_v1", whichAssembly="2", chr, CNEstart, CNEend, windowSize, minLength) |
|
| 44 |
+listToPlot = list(hg19_canFam3_len50_id900_300 = hg19_canFam3_len50_id900_300, hg19_canFam3_len50_id960_300 = hg19_canFam3_len50_id960_300, hg19_canFam3_len50_id980_300 = hg19_canFam3_len50_id980_300) |
|
| 45 |
+p = plotCNE(listToPlot, horizonscale=4, nbands=5) |
|
| 46 |
+zoomLevel = c(45000000, 60000000) |
|
| 47 |
+p+xlim(range(zoomLevel)) |
|
| 48 |
+ |
|
| 49 |
+## genomic features |
|
| 50 |
+library(TxDb.Hsapiens.UCSC.hg19.knownGene) |
|
| 51 |
+txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene |
|
| 52 |
+aldoa.gr <- GRanges(chr, IRanges(zoomLevel[1], zoomLevel[2])) |
|
| 53 |
+library(ggbio) |
|
| 54 |
+p1 <- autoplot(txdb, which = aldoa.gr, stat = "reduce") |
|
| 55 |
+p2 = tracks(knownGene = p1, CNE = p) + xlim(zoomLevel[1], zoomLevel[2]) |
|
| 56 |
+ |
|
| 57 |
+ |
|
| 58 |
+### Gviz way |
|
| 59 |
+genome = "hg19" |
|
| 60 |
+strand = "+" |
|
| 61 |
+chr = "chr16" |
|
| 62 |
+dataMatrix= hg19_canFam3_len50_id900_300 |
|
| 63 |
+dTrack1 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horizon", fill.horizonScale=4, ylim=c(0,4), name="hg19_canFam3_len50_id900_300") |
|
| 64 |
+dataMatrix = hg19_canFam3_len50_id960_300 |
|
| 65 |
+dTrack2 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horizon", fill.horizonScale=4, ylim=c(0,4), name="hg19_canFam3_len50_id960_300") |
|
| 66 |
+dataMatrix = hg19_canFam3_len50_id980_300 |
|
| 67 |
+dTrack3 = DataTrack(start=dataMatrix[ ,1], end=dataMatrix[ ,1], data=dataMatrix[ ,2], chromosome=chr, strand=strand, genome=genome, type="horizon", fill.horizonScale=4, ylim=c(0,4), name="hg19_canFam3_len50_id980_300") |
|
| 68 |
+ |
|
| 69 |
+axisTrack <- GenomeAxisTrack() |
|
| 70 |
+ideoTrack <- IdeogramTrack(genome = "hg19", chromosome = chr) |
|
| 71 |
+geneAnnotation = queryAnnotationSQLite(dbname="/Users/gtan/Dropbox/Project/CSC/CNEr/geneAnnotation.sqlite", tablename="hg19_refGene", chr="chr16", start= 45000000, end= 60000000) |
|
| 72 |
+grtrack <- GeneRegionTrack(geneAnnotation, genome = "hg19", chromosome = chr, name = "refGene") |
|
| 73 |
+plotTracks(list(ideoTrack, axisTrack, grtrack, dTrack1, dTrack2, dTrack3), collapseTranscripts = TRUE, shape = "arrow", from= 45000000, to=60000000, showId = TRUE, extend.left = 20000) |
|
| 74 |
+ |
|
| 75 |
+ |
| 0 | 76 |
new file mode 100644 |
| ... | ... |
@@ -0,0 +1,39 @@ |
| 1 |
+> xyplot(y~x, panel = function(x,y,...){for (i in 0:round(max(y)/2,0)) panel.xyarea(x,y=ifelse(y>0,y,NA)-(scale * i),col="green",border="green", alpha=0.4)})
|
|
| 2 |
+ |
|
| 3 |
+fooColors=c("red","blue","yellow")
|
|
| 4 |
+scale=2 |
|
| 5 |
+xyplot(y~x, xlab=NULL,ylab=NULL, ylim=c(0, scale),origin=0, |
|
| 6 |
+panel = function(x,y,...){for (i in 0:round(max(y)/scale,0)) panel.xyarea(x,y=ifelse(y>0,y,NA)-(scale * i),col=fooColors[i+1],border="green")})
|
|
| 7 |
+xyplot(y~x, xlab=NULL,ylab=NULL, ylim=c(0, scale),origin=0, |
|
| 8 |
+panel = function(x,y,...){for (i in 1:(round(max(y)/scale,0)+1)) panel.xyarea(x,y=ifelse(y>0,y,NA)-(scale * (i-1)),col=fooColors[i],border="green")})
|
|
| 9 |
+ |
|
| 10 |
+ |
|
| 11 |
+rm Gviz_1.4.4.tar.gz |
|
| 12 |
+R CMD build Gviz/ |
|
| 13 |
+R CMD INSTALL Gviz_1.4.4.tar.gz |
|
| 14 |
+remove.packages("Gviz")
|
|
| 15 |
+library(Gviz) |
|
| 16 |
+data(twoGroups) |
|
| 17 |
+dTrack <- DataTrack(twoGroups, name = "uniform") |
|
| 18 |
+plotTracks(dTrack) |
|
| 19 |
+ |
|
| 20 |
+library(lattice) |
|
| 21 |
+library(GenomicRanges) |
|
| 22 |
+library(latticeExtra) |
|
| 23 |
+set.seed(10) |
|
| 24 |
+foo = GRanges(seqnames=seqnames(twoGroups), ranges=ranges(twoGroups), y=runif(25,1,6)) |
|
| 25 |
+dTrack <- DataTrack(foo, name = "uniform", type="horizon", fill.horizonScale=2, ylim=c(0,2)) |
|
| 26 |
+plotTracks(dTrack) |
|
| 27 |
+ |
|
| 28 |
+ |
|
| 29 |
+ans = queryAnnotationSQLite(dbname="/Users/gtan/Dropbox/Project/CSC/CNEr/geneAnnotation.sqlite", tablename="hg19_refGene", chr="chr3", start=158500001, end=160200000) |
|
| 30 |
+grtrack <- GeneRegionTrack(ans, genome = "hg19", chromosome = "chr3", name = "foo") |
|
| 31 |
+axisTrack <- GenomeAxisTrack() |
|
| 32 |
+ideoTrack <- IdeogramTrack(genome = "hg19", chromosome = "chr3") |
|
| 33 |
+plotTracks(list(ideoTrack,axisTrack,grtrack), collapseTranscripts = TRUE, shape = "arrow", extend.left = 20000, showId = TRUE) |
|
| 34 |
+ |
|
| 35 |
+ |
|
| 36 |
+ |
|
| 37 |
+ |
|
| 38 |
+ |
|
| 39 |
+ |